Biology
2250 - Principles of Genetics - Dr. Carr
Sample exam questions (for Midterms I & II, &
Final Exam)
These examples
are intended to show the STYLE
of questions that MAY
be asked on exams, NOT the specific questions
that will be asked.
For all exams, you will be
given a sheet with the Universal Genetic Code: therefore
it is not necessary to memorize the genetic
code.
I. MOLECULAR BIOLOGY: For each question, indicate in the
space provided the LETTER of the ONE response that best
answers the question.
______
In double-stranded RNA
regions, the bonds that hold complementary nucleotides
together are described as
A.
ionic
B. covalent
C. hydrophobic D. hydrogen
E. hydrophilic
______ A ribonucleoside
includes a two-ring nitrogenous group with two H-bonds.
It is best described as:
A. dA
B. dC
C.
dG
D. dT
E. dU
_______ If the sequence of a codon
is 5'‑C³Ò´¡â€‘3' , the
sequence of the corresponding template strand is
A.
5'-CGA-3' B. 5'-TCG-3' C. 5'‑U°ä³Ò‑3'
D. 5'-AGC-3'
E. 5'-GCT-3'
F.
5'-GCU-3'
For each of the following, indicate the type(s) of nucleic acid in which they are found [use ds, hn, m, r, and t for dsDNA, hnRNA, mRNA, rRNA, tRNA]
________ ,
________
exons, codons
________ , ________
introns, anticodons
________ ,
________
E sites, initiation sites
______ If the template strand of a
piece of DNA reads 3' - AAAAAATTT - 5', its
protein product will read:
A. H3N - F
F K - COOH B.
HOOC - F K K - NH3
C. H3N - K F F -
COOH D. HOOC - K
K F - NH3
______
The tertiary structure of protein is determined by
A.
beta
sheets B. hydrogen bonds
C. disulfide bonds D. alpha helices
E. subunit arrangement
______ The active site of an
enzyme is most likely
to be composed of amino acids with the following
characteristics:
A.
Polar
&
Hydrophobic B.
Polar & Hydrophilic C. Non-polar &
Hydrophobic D. Non-polar & Hydrophilic
______
Semi-conservative DNA replication was demonstrated
by
A. Watson &
Crick B. Meselson &
Stahl C. Hershey &
Chase D. Luria & Delbruck
E. Penn & Teller
II. MOLECULAR GENETICS. Each of the following five
statements contains a basic misconception about genetics. In not
more than three grammatically complete sentences,
identify and correct the error. Do NOT exceed the space
provided. Do NOT draw diagrams.
Ex.: "Because it has higher energy, gamma radiation is
always more mutagenic than alpha radiation."
Sample answer: Gamma radiation is more
energetic than alpha, but that energy is dispersed over a
much longer path length, so it has a lower linear energy
transfer (LET) than alpha radiation.
The
higher LET of alpha radiation means that its lower energy
will be dispersed over a very short path.
If
the energy is released within the nucleus of a single cell
near a chromosome, it will be highly mutagenic.
Ex.: "DNA probes
anneal to particular SNPs and are responsible for genetic
diseases."
Ex.: "Met- mutants are caused by a defect of methionine that block its synthesis."
Ex.: "Most people do not have Cystic Fibrosis because
they do not have the gene for Cystic Fibrosis."
III. MENDELIAN GENETICS. For each question, indicate in the
space provided the LETTER of the ONE response that best answers
the question.
______ A woman is heterozygous for an
X-linked recessive allele that causes night-blindness. If she
marries a man with night-blindness, what proportions of her
female & male offspring will carry the night-blindness
allele?
A) all,
none B) all,
half C) half,
half D) half,
none E) none, half
F) none, all
______ In Trufula trees, the locus for leaf
color has three alleles: R
(red), G (green), and
B (brown). R is dominant to G, G is dominant to B. In the progeny of the
cross BR x BG, what fraction will be
brown ?
A)
All B)
3/4 C)
1/2 D)
1/4 E) 0
______ Two individuals heterozygous for semi-dominant traits
at four loci are crossed: how many F2 genotypes are
expected?
A)
4 B) 9 C)
16 D) 27
E) 32
F) 64 G) 81
Sample answers: Your parents might both
be Bb
heterozygotes with brown eyes, and you could be a blue-eyed
bb homozygote with blue eyes.
Eye color is likely a polygenic trait with multiple genes
involved, so its inheritance is not that simple.
Ex.: Two people both
heterozygous for a recessive autosomal disease have a first
child born with the disease. Their physician tells them, "Don't
worry, your next three children will not have the disease."
IV. GENETIC STRUCTURES: Enter the correct LETTER for
each of the NUMBERED structure [see example].
The following DNA is part of a gene that
codes for a polypeptide of at least seven amino acids:
3' caattgattagtcagtcaattgat 5'
5' gttaactaatcagtcagttaacta 3'
i. Which strand includes an Open Reading Frame? Top (T) or Bottom (B) [2 pts]
ii. Which DNA strand is the sense strand? Top (T) or
Bottom (B) [2
pts]
iii. Give the mRNA sequence that would be
transcribed from this gene; label the 5' & 3'
ends. [3 pts]
iv. Give the seven
amino acids that would be translated from the correct
message; label the C & N ends. [5 pts]
Additional
translation problems can be generated from the app RandomORF
VI. PEDIGREE
ANALYSIS: Given the pedigree shown, which of
the six modes of inheritance are possible?
Which is most likely? What observations would
change this?
VII.
TRI-HYBRID THREE-POINT TEST
CROSS: From the following recombination data,
draw a physical map to indicate the correct order and
distances between loci.
VIII. RESTRICTION
MAPPING:
From the following fragment size data, draw a restriction map.
Label the sites, provide a scale.
Watson & Crick received
the Nobel Prize in what year?
(a) 1953 (b) 1962 (c) 1973
(d) 1984
Transcription proceeds in which
of the following directions
(a) 3'
1' (b) 2'
4' (c) 3'
5' (d) 4'
6' (e) 5'
3'
Which carbon differs between
ribose and deoxyribose sugars? (a) 1' (b)
2' (c) 3' (d)
4' (e) 5'
Which of the following amino
acids is/are non-polar?
(a)
Draw the structure of
Deoxyadenosine monophosphate.
Outline the process of
DNA replication.
What are
the clues for
sex-linked inheritance?
How many introns are present in the chicken ovalbumin gene? (a) 4 (b) 5 (c) 6 (d)
7 (e) more than 7
Text material © 2016 by Steven M. Carr